View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11801_low_17 (Length: 225)
Name: NF11801_low_17
Description: NF11801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11801_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 62 - 132
Target Start/End: Complemental strand, 32304616 - 32304546
Alignment:
| Q |
62 |
agtttggtttatgaaggtgacatgattaacttggttgctttttcatggtttgaaacatttgttctctcttt |
132 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32304616 |
agtttggtttatgaaggtgacatgatcaacttggttgctttttcatggtttgaaacatttgttctctcttt |
32304546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 160 - 209
Target Start/End: Complemental strand, 32304551 - 32304501
Alignment:
| Q |
160 |
ctctttgcatgatttcccttctctc-ttgattcttctaactggttgcattg |
209 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||||| ||||||||||| |
|
|
| T |
32304551 |
ctctttgcatgatttcacttctctcgttgattcttctaattggttgcattg |
32304501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University