View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11803_low_4 (Length: 285)
Name: NF11803_low_4
Description: NF11803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11803_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 2e-64; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 18 - 146
Target Start/End: Complemental strand, 8880666 - 8880538
Alignment:
| Q |
18 |
aagagcggagatttttgagcttattagtcagcttgaggctaagaatccaacccccgcttccactgatgctttgagtttgctcgatggaaaatggattctt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8880666 |
aagagcggagatttttgagcttattagtcagctcgaggctaagaatccaacccccgcttccactgatgctttgagtttgctcgatggaaaatggattctt |
8880567 |
T |
|
| Q |
118 |
gcgtaagcaaattcgttttactaactttc |
146 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
8880566 |
gcgtaagcaaattcgttttactaactttc |
8880538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 214 - 279
Target Start/End: Complemental strand, 8880470 - 8880405
Alignment:
| Q |
214 |
ttgttagacaatgatttgtgtttggaagggaattctcatattctgcttattattaatgttaacttt |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8880470 |
ttgttagacaatgatttgtgtttggaagggaattctcatattctgcttattattaatgttaacttt |
8880405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 19 - 124
Target Start/End: Complemental strand, 8884767 - 8884662
Alignment:
| Q |
19 |
agagcggagatttttgagcttattagtcagcttgaggctaagaatccaacccccgcttccactgatgctttgagtttgctcgatggaaaatggattcttg |
118 |
Q |
| |
|
||||| |||||| |||||||||||| |||||| || ||||||||||| || || |||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
8884767 |
agagctgagattgttgagcttattactcagctggaagctaagaatcccacacctgcttccactgatgccttgagtttgctcaatggaaaatggattcttg |
8884668 |
T |
|
| Q |
119 |
cgtaag |
124 |
Q |
| |
|
|||||| |
|
|
| T |
8884667 |
cgtaag |
8884662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 18 - 146
Target Start/End: Complemental strand, 45073805 - 45073677
Alignment:
| Q |
18 |
aagagcggagatttttgagcttattagtcagcttgaggctaagaatccaacccccgcttccactgatgctttgagtttgctcgatggaaaatggattctt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| ||| ||||| |||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45073805 |
aagagcggagatttttgagcttattagtcagctcgaggctaagtttcccacccctgcttccactgatgccttgagtttgctcgatggaaaatggattctc |
45073706 |
T |
|
| Q |
118 |
gcgtaagcaaattcgttttactaactttc |
146 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
45073705 |
gcgtaagcaaattcgttttactaactttc |
45073677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 214 - 278
Target Start/End: Complemental strand, 45073611 - 45073546
Alignment:
| Q |
214 |
ttgttagacaatgatttgtgtttggaagggaa-ttctcatattctgcttattattaatgttaactt |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||| |||||||||||||| | |||||||| |
|
|
| T |
45073611 |
ttgttagacaatgatttgtgtttggaagggaacttatcatgttctgcttattattgacgttaactt |
45073546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University