View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11804_high_19 (Length: 243)
Name: NF11804_high_19
Description: NF11804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11804_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 11 - 226
Target Start/End: Complemental strand, 55243492 - 55243295
Alignment:
| Q |
11 |
cacagacccaaacggaaccaacacattatgaaatgagctttccactcataaaaggagcacggttcttactacaaaaccacttccacgaggaaagctcttt |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55243492 |
cacaaacccaaacggaaccaacacattatgaaatgagctttccactcataaaaggagcacggttcttactacaaaaccacttcca--------------- |
55243408 |
T |
 |
| Q |
111 |
gaaatttatgtgcttttggnnnnnnncttaggggacgtgctcttggttgatgggtggaagactatttataagctcagtttgactgaaacattatcttcta |
210 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55243407 |
---atttatgtgcttttggtttttttcttaggggacgtgctcttggttgatgggtggaagactatttataagctcagtttgactgaaacattatcttcta |
55243311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University