View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11804_low_17 (Length: 262)
Name: NF11804_low_17
Description: NF11804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11804_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 17 - 133
Target Start/End: Original strand, 14771358 - 14771474
Alignment:
| Q |
17 |
aagaaaagctacaaagaagaattaatattgttgactggagtcacagttttatttgttcattatgtgaattttatagttgttcttttttatgagagcaaga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
14771358 |
aagaaaagctacaaagaagaattaatattgttgactggagtcacagttttatttgctcattatctgaattttatagttgttcttttttatgagagcaaga |
14771457 |
T |
 |
| Q |
117 |
ccgtttatgattataat |
133 |
Q |
| |
|
| ||||||||||||||| |
|
|
| T |
14771458 |
cagtttatgattataat |
14771474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 228 - 262
Target Start/End: Original strand, 14771572 - 14771606
Alignment:
| Q |
228 |
aagtcaggattcgttgacacaagtgttaaatggtt |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
14771572 |
aagtcaggattcgttgacacaagtgttaaacggtt |
14771606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University