View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11804_low_23 (Length: 237)
Name: NF11804_low_23
Description: NF11804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11804_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 46 - 222
Target Start/End: Complemental strand, 12607417 - 12607241
Alignment:
| Q |
46 |
aaatctaaataaatcgtacttataagttagaactctatatatttgatattgcaaaaccaattatagaacagttaagttcgattccaaatgcattgtgcct |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12607417 |
aaatctaaataaatcgtacttataagttagaactctatatatttgatattgcaaaaccaattatagaacagttaagttcgattccaaatgcattgtgcct |
12607318 |
T |
|
| Q |
146 |
taatttacctttcccacgggaggatgagcaacttgattacgactagcttccctgagacgctcgaccgacataaaatt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12607317 |
taatttacctttcccacgggaggatgagcaacttgattacgactagcttccctgagacgctcgaccgacataaaatt |
12607241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 86 - 207
Target Start/End: Original strand, 16679321 - 16679442
Alignment:
| Q |
86 |
atttgatattgcaaaaccaattatagaacagttaagttcgattccaaatgcattgtgccttaatttacctttcccacgggaggatgagcaacttgattac |
185 |
Q |
| |
|
||||||||||||||| | ||| ||| ||||||||| ||| ||||||||||||||||||||||| |||||||| ||| || || |||| || |||||| |
|
|
| T |
16679321 |
atttgatattgcaaatctaatgataaaacagttaatttccattccaaatgcattgtgccttaacttaccttttgcacaccagaataagcagctggattac |
16679420 |
T |
|
| Q |
186 |
gactagcttccctgagacgctc |
207 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
16679421 |
gactagcttccctgagacgctc |
16679442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University