View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11804_low_27 (Length: 219)
Name: NF11804_low_27
Description: NF11804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11804_low_27 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 37 - 219
Target Start/End: Original strand, 12607985 - 12608167
Alignment:
| Q |
37 |
tagagtatggttttattaggctgttcagctttattgggtattttagtctacagagaagttttcactgcaaacatttagaggcttttgagttttgacgatt |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12607985 |
tagagtatggttttattaggctgttcagctttattgagtattttactctacagagaagttttcactgcaaacatttagaggcttttgagttttgacgatt |
12608084 |
T |
 |
| Q |
137 |
caacgatatacaattcaagtatctgagtttgagttgttggtgcacccttccttgcctgcattctagcttaccttccttcattc |
219 |
Q |
| |
|
||| |||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12608085 |
caaggatatacaattcgagtatctgagtttgagttgttggtgcacccttccttggctgcattctagcttaccttccttcattc |
12608167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University