View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11805_high_10 (Length: 266)
Name: NF11805_high_10
Description: NF11805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11805_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 28414893 - 28415144
Alignment:
| Q |
1 |
ttataagctgatttaaaatgtcttataaagtaatggaagcaaaaagatggcatacaataaagctattgaagcccgaacaatctagggaaattctatctca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28414893 |
ttataagctgatttaaaatgtcttataaagtaatggaagcaaaaagatggcatacaatgaagctattgaagcccgaacaatctagggaaattctatctca |
28414992 |
T |
 |
| Q |
101 |
agttctgaactcatgccaaagaggaaaagcacttgaaggctgaaatcactgagtgatctctggtccatatgccctagtgcacatagtccatggaatggtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
28414993 |
agttctgaactcatgccaaagaggaaaagcacttgaaggctgaaatcactgagttatctctggtccatttgccctagtgcacatagtccatgcaatggtg |
28415092 |
T |
 |
| Q |
201 |
tcaagaa-ctacaaaaattatctatttacgagtatgctatacccagaatatt |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28415093 |
tcaagaacctacaaaaattatctatttacgagtatgctatacccagaatatt |
28415144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University