View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11805_low_13 (Length: 270)
Name: NF11805_low_13
Description: NF11805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11805_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 43 - 257
Target Start/End: Complemental strand, 27572506 - 27572292
Alignment:
| Q |
43 |
ttacgaaatgttgattttgtgattcacactccttgtatataagtagaaaataatacaccaattgccatatgtaaaatgaattgattctttttcaaatgca |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27572506 |
ttacgaaatgttgattttgtgattcacactccttgtatataagtagaaaataatacaccaattgccatatgtaaaatgaattgattctttttcaaatgca |
27572407 |
T |
 |
| Q |
143 |
tatattgcattatttcttatagaataatgttaatgattctcgtaaatgttgcttctattaaacccatttgtgttagcatggtgttattgacttggaaatt |
242 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||| || |
|
|
| T |
27572406 |
tatattgcattattgcttatagaataatgttaatgattctcgtaaatgttgcttctattaaactcatttgtgttagcatggtggtattgacttggaagtt |
27572307 |
T |
 |
| Q |
243 |
gggagtgtgttcatc |
257 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
27572306 |
gggagtgtgttcatc |
27572292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University