View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11805_low_15 (Length: 254)
Name: NF11805_low_15
Description: NF11805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11805_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 15 - 153
Target Start/End: Complemental strand, 45342476 - 45342338
Alignment:
| Q |
15 |
caaaggacatgagcagcatctcttcttcttcatcaatttcaacatagtttgcactttccttccatcttgggaattcatattggaaatgtcctagtttgtg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45342476 |
caaaggacatgagcagcatctcttcttcttcatcaatttcaacatagtttgcactttccttccatcttgggcattcatattggaaatgtcctagtttgtg |
45342377 |
T |
|
| Q |
115 |
acatttaaaacactccactatggctttgtttgcaaattg |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45342376 |
acatttaaaacactccactatggctttgtttgcaaattg |
45342338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 216 - 254
Target Start/End: Complemental strand, 45342275 - 45342237
Alignment:
| Q |
216 |
cattttgatcttcatgtgaaaccttcaacgcttgctcat |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45342275 |
cattttgatcttcatgtgaaaccttcaacgcttgctcat |
45342237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University