View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11805_low_18 (Length: 228)
Name: NF11805_low_18
Description: NF11805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11805_low_18 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 7 - 228
Target Start/End: Original strand, 30797169 - 30797390
Alignment:
| Q |
7 |
gatttatgtgggtttggtgccaccgtccacacctgttccagaaaccaagatgagcttaataattgtttgaatcaatggcgtagtaaaggctttttggtgt |
106 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30797169 |
gatttatgtgggtttggtgctaccgtccacacctgttccagaaaccaagatgagcttaataattgtttgaatcaatggcgtagtaaaggctttttggtgt |
30797268 |
T |
 |
| Q |
107 |
ctggatccgtgtgtgatgtctcatctcgagaacaaagggagaagctcattcaagaagttgcctcaatcttcaatggtaaacttcacatttatgtaagtaa |
206 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
30797269 |
ctggatctgtgtgtgatgtctcatctcgagaacaaagggagaagctcattcaagaagttgcctcaatcttcaatggtaaacttcacatttatgtaagtca |
30797368 |
T |
 |
| Q |
207 |
tgctcgattaatttttgcacat |
228 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
30797369 |
tgctcgattaatttttgcacat |
30797390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University