View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11805_low_21 (Length: 206)
Name: NF11805_low_21
Description: NF11805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11805_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 68; Significance: 1e-30; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 93 - 195
Target Start/End: Complemental strand, 45646977 - 45646874
Alignment:
| Q |
93 |
acttgtaggtagctatacgcttcaatttatcttatttttacttcttaaaaaca-nnnnnnnnaaggaacttcttaaaatcatggcaatttgatttcctat |
191 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45646977 |
acttgtagatagctatacgcttcaatttatcttatttttacttcttaaaaacatttttttttaaggaacttcttaaaatcatggcaatttgatttcctat |
45646878 |
T |
|
| Q |
192 |
gctt |
195 |
Q |
| |
|
|||| |
|
|
| T |
45646877 |
gctt |
45646874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 22 - 74
Target Start/End: Complemental strand, 45647109 - 45647057
Alignment:
| Q |
22 |
acggtcacgtcattcttaacatgaaagattttctatgcttatattgcacaaaa |
74 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45647109 |
acggtcacatcattcttaacatgaaagattttctatgcttatattgcacaaaa |
45647057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University