View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11805_low_9 (Length: 300)
Name: NF11805_low_9
Description: NF11805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11805_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 142 - 282
Target Start/End: Original strand, 45341921 - 45342061
Alignment:
| Q |
142 |
gagtgaacagtgaagagagcgcaattgcaagcgttgaggaaggactttgaagtccttcaaatgaaagaaggagaaaaagtggacgagtactttgctcgga |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45341921 |
gagtgaacagtgaagagagcgcaattgcaagcgttgaggaaggagtttgaagtccttcaaatgaaagaaggagaaaaagtggacgagtactttgctcgga |
45342020 |
T |
|
| Q |
242 |
cgcttacaattgtaaagaaaatgaagatttatggtgagaac |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45342021 |
cgcttacaattgtaaagaaaatgaagatttatggtgagaac |
45342061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 18 - 143
Target Start/End: Original strand, 45341520 - 45341645
Alignment:
| Q |
18 |
attggtatcaaagctctttcaaagggcctgatcgagtgagactaggaactgcagtttccaaaagagagagtgagaaatgtcatctgaaagtagcaacttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45341520 |
attggtatcaaagctctttcaaagggcctgatcgagtgagactaggaactgcagtttccaaaagagagagtgagaaatgtcatctgaaagtagcaacttt |
45341619 |
T |
|
| Q |
118 |
gtgcaaccagcaatccctaagtttga |
143 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
45341620 |
gtgcaaccagcaatccctaagtttga |
45341645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 202 - 269
Target Start/End: Complemental strand, 20451555 - 20451488
Alignment:
| Q |
202 |
atgaaagaaggagaaaaagtggacgagtactttgctcggacgcttacaattgtaaagaaaatgaagat |
269 |
Q |
| |
|
||||| ||||||||| |||||| |||||||||||||| || || ||||||| ||| ||||||||||| |
|
|
| T |
20451555 |
atgaaggaaggagaaggagtggatgagtactttgctcgtactctaacaattgcaaacaaaatgaagat |
20451488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University