View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11807_high_11 (Length: 268)
Name: NF11807_high_11
Description: NF11807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11807_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 9e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 15 - 253
Target Start/End: Original strand, 27582541 - 27582776
Alignment:
| Q |
15 |
gatacaactcgctcatatcatctctctcattctctannnnnnnnnggtatgaatgaacggcgttctagtttttgattttataatagtgtgccacggtcgt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
27582541 |
gatacaactcgctcatatcatctctctcattctctattttttt--ggcatgaatgaacggcgttctagtttttgattttataatagtgtgccgcggtcgt |
27582638 |
T |
 |
| Q |
115 |
aggtcgtattgatgtattgtcacgattataatcgccgtttcgctgtgatttttattctacaccaaacatgtnnnnnnnggtaacagtatctactttttgt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| ||||||||||| |||||| |||||||||||| | |
|
|
| T |
27582639 |
aggtcgtattgatgtattgtcacgattataatcgccgttttgctgtgatttttcttctaaaccaaacatgt-aaaaaaggtaacggtatctacttttagc |
27582737 |
T |
 |
| Q |
215 |
aacgctcgaaatctcaaatattttttaaaccttggaaat |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27582738 |
aacgctcgaaatctcaaatattttttaaaccttggaaat |
27582776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University