View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11807_high_15 (Length: 247)
Name: NF11807_high_15
Description: NF11807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11807_high_15 |
 |  |
|
| [»] scaffold0449 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0449 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: scaffold0449
Description:
Target: scaffold0449; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 18 - 247
Target Start/End: Complemental strand, 2417 - 2188
Alignment:
| Q |
18 |
cttgaaaatttggcgctaactaacttgtttgattttctaaccgatgatgatcgtgactattcggttatgcgttcgttaattgcagctttacactatttat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2417 |
cttgaaaatttggcgctaactaacttgtttgattttctaaccgataatgatcgtgactattcggttatgcgttcgttaattgcagctttacactatttat |
2318 |
T |
 |
| Q |
118 |
aaattggataacgaacgtggatactaatgcttattttgttattatgaaatggatttcatttgatatttttgtacactaatggtttatataaattaaattt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2317 |
aaattggataacgaacgtggatactaatgcttattttgttattatgaaatggatttcatttgatatttttgtacactaatggtttatataaattaaattt |
2218 |
T |
 |
| Q |
218 |
attaaaaacttgaaggtgagctcaaatact |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2217 |
attaaaaacttgaaggtgagctcaaatact |
2188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University