View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11807_high_17 (Length: 239)
Name: NF11807_high_17
Description: NF11807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11807_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 4 - 224
Target Start/End: Original strand, 39883714 - 39883934
Alignment:
| Q |
4 |
aataaatgtgcatactttcttgcacacccgtgatgcgaactccaccaatttagttaggtaatgcaattccattgttagaaggnnnnnnnnnccgtcattg |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39883714 |
aataaatgtgcatactttcttgcacacccgtgatgtgaactccaccaatttagttaggtaatgcaattccattgttagaaggaaaaaaaaaccgtcattg |
39883813 |
T |
 |
| Q |
104 |
catgttctttaagccataagcaaacaaatgttgtcaatgcaactcttttttctaccccttttatacattatgtctataagttatagtaccactattttac |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
39883814 |
catgttctttaagccataagcaaacaaatgttgtcaatgcaactcttttttctaccccttttaaatattatgtctataagttatagtaccactattttac |
39883913 |
T |
 |
| Q |
204 |
aatcactcccacgtgttactt |
224 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
39883914 |
aatcactcccacgtgttactt |
39883934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University