View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11808_low_3 (Length: 361)
Name: NF11808_low_3
Description: NF11808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11808_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 17 - 173
Target Start/End: Complemental strand, 56312078 - 56311922
Alignment:
| Q |
17 |
caggaagttcccaagggtcatagcgataaagatcgagaaaagtaataagctcaacgttgaaacgttttccctcgaccttacggcgaaggtagaactctac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56312078 |
caggaagttcccaagggtcatagcgataaagatcgagaaaagtaataagctcaacgttgaaacgttttccctcgaccttacggcgaaggtagaactctac |
56311979 |
T |
|
| Q |
117 |
aagttcttcttcagttggatggaaacgaaaccctggcataaccacgtcatgctcgtg |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56311978 |
aagttcttcttcagttggatggaaacgaaaccctggcataaccacgtcatgctcgtg |
56311922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 146; E-Value: 8e-77
Query Start/End: Original strand, 195 - 340
Target Start/End: Complemental strand, 56311894 - 56311749
Alignment:
| Q |
195 |
tactactgtaactgtagctgtagctcctttgttaatattatcgttagaagttccatcttcgtgactcaagctcatgctgctcatgttaggtgatgatgtt |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56311894 |
tactactgtaactgtagctgtagctcctttgttaatattatcgttagaagttccatcttcgtgactcaagctcatgctgctcatgttaggtgatgatgtt |
56311795 |
T |
|
| Q |
295 |
gctgctgctattgccatccactctctctaactaactaacaacaaca |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56311794 |
gctgctgctattgccatccactctctctaactaactaacaacaaca |
56311749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 115 - 152
Target Start/End: Complemental strand, 8449761 - 8449724
Alignment:
| Q |
115 |
acaagttcttcttcagttggatggaaacgaaaccctgg |
152 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
8449761 |
acaagttcttcatcagttgggtggaaacgaaaccctgg |
8449724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University