View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11809_high_35 (Length: 367)

Name: NF11809_high_35
Description: NF11809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11809_high_35
NF11809_high_35
[»] chr6 (3 HSPs)
chr6 (1-223)||(14567873-14568094)
chr6 (55-193)||(11142068-11142206)
chr6 (52-158)||(19165777-19165882)
[»] chr4 (1 HSPs)
chr4 (90-176)||(22746021-22746108)
[»] chr7 (2 HSPs)
chr7 (98-180)||(32221309-32221391)
chr7 (89-123)||(13058204-13058238)
[»] chr1 (1 HSPs)
chr1 (13-137)||(2369193-2369318)
[»] scaffold0007 (1 HSPs)
scaffold0007 (143-209)||(781-847)
[»] chr2 (1 HSPs)
chr2 (81-174)||(22262726-22262823)
[»] scaffold0031 (1 HSPs)
scaffold0031 (88-122)||(101543-101577)


Alignment Details
Target: chr6 (Bit Score: 203; Significance: 1e-111; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 14568094 - 14567873
Alignment:
Q  1 tggcggtgactctagggcacgcctaggacaactaggccggagtgtttcaccggcggagaggtacaataggtggagagggttccagctagggtggcagaaa 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
T  14568094 tggcggtgactctagggcacgcctaggacaactaggccggagtgtttcaccggcggagaggtacaataggtggaaagggttccagctagggtggcagaaa 14567995  T
Q  101 ttggggggataggggaaattggtctatggtcaggtcatgcaggaggaaagcgacgcaaccagaggatagaggacgggacatgtcaaaggtttcgaagcgg 200  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||    
T  14567994 ttggggg-ataggggaaattggtctatggtcaggtcatgcaggaggaaagcgacgcaaccggaggatagaggacgggacatgtcaagggtttcgaagcgg 14567896  T
Q  201 caaggaggagcggtattggttag 223  Q
    |||||||||||||||||||||||    
T  14567895 caaggaggagcggtattggttag 14567873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 55 - 193
Target Start/End: Complemental strand, 11142206 - 11142068
Alignment:
Q  55 ggagaggtacaataggtggagagggttccagctagggtggcagaaattggggggataggggaaattggtctatggtcaggtcatgcaggaggaaagcgac 154  Q
    |||||| |||| | || ||| |||| ||||||  |||||||| | |||||||||||||| |  |||||||| | || |||||  | | ||||||||||||    
T  11142206 ggagagatacattggggggataggggtccagcctgggtggcaaatattggggggataggagtgattggtctgtagttaggtctaggaagaggaaagcgac 11142107  T
Q  155 gcaaccagaggatagaggacgggacatgtcaaaggtttc 193  Q
    |||||| |||||| |||||||||||| ||||| ||||||    
T  11142106 gcaaccggaggatcgaggacgggacaggtcaagggtttc 11142068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 52 - 158
Target Start/End: Original strand, 19165777 - 19165882
Alignment:
Q  52 ggcggagaggtacaataggtggagagggttccagctagggtggcagaaattggggggataggggaaattggtctatggtcaggtcatgcaggaggaaagc 151  Q
    |||||||||| ||| | || ||| |||| |||||| ||||||| |||||||||||| || |||||||||||||  |||| |||||| | | |||||||||    
T  19165777 ggcggagaggaacattggggggataggggtccagccagggtggaagaaattggggg-atcggggaaattggtccgtggttaggtcaaggaagaggaaagc 19165875  T
Q  152 gacgcaa 158  Q
    |||||||    
T  19165876 gacgcaa 19165882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 90 - 176
Target Start/End: Complemental strand, 22746108 - 22746021
Alignment:
Q  90 ggtggcagaaattgggggga-taggggaaattggtctatggtcaggtcatgcaggaggaaagcgacgcaaccagaggatagaggacgg 176  Q
    ||||||||||| |||||||| ||||||| |||||||| | || |||||| | | ||||||||||||||||||||||||| ||||||||    
T  22746108 ggtggcagaaaatggggggaataggggagattggtctgtagttaggtcaagaaagaggaaagcgacgcaaccagaggatcgaggacgg 22746021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 98 - 180
Target Start/End: Complemental strand, 32221391 - 32221309
Alignment:
Q  98 aaattggggggataggggaaattggtctatggtcaggtcatgcaggaggaaagcgacgcaaccagaggatagaggacgggaca 180  Q
    |||| ||||||||||||||||||||||| | || |||||  | | |||||||||||||||||| |||||| ||||||||||||    
T  32221391 aaatgggggggataggggaaattggtctctagttaggtctaggaagaggaaagcgacgcaaccggaggatcgaggacgggaca 32221309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 89 - 123
Target Start/End: Original strand, 13058204 - 13058238
Alignment:
Q  89 gggtggcagaaattggggggataggggaaattggt 123  Q
    |||| ||||||||||||||||||||||||||||||    
T  13058204 gggtagcagaaattggggggataggggaaattggt 13058238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 13 - 137
Target Start/End: Complemental strand, 2369318 - 2369193
Alignment:
Q  13 tagggcacgcctaggacaactaggccggagtgtttcaccggcggagaggtacaataggtggagagggttccagctagggtggcagaaattgggggg-ata 111  Q
    ||||||| ||||||| |||||  |||||||    |||||||| |||||| ||| | || |||  ||| |||||| ||||||||||||||||||||| ||     
T  2369318 tagggcaagcctagggcaactgcgccggagcaactcaccggctgagaggaacattggggggatcggggtccagccagggtggcagaaattgggggggatg 2369219  T
Q  112 ggggaaattggtctatggtcaggtca 137  Q
    |||||||||||||| |||||||||||    
T  2369218 ggggaaattggtctgtggtcaggtca 2369193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0007 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: scaffold0007
Description:

Target: scaffold0007; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 143 - 209
Target Start/End: Complemental strand, 847 - 781
Alignment:
Q  143 gaggaaagcgacgcaaccagaggatagaggacgggacatgtcaaaggtttcgaagcggcaaggagga 209  Q
    |||||||||||| |||||  ||||| |||||||||||||||||| |||||| |||||||| ||||||    
T  847 gaggaaagcgacacaaccgaaggatcgaggacgggacatgtcaagggtttcaaagcggcatggagga 781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 81 - 174
Target Start/End: Complemental strand, 22262823 - 22262726
Alignment:
Q  81 tccagctagggtggcagaaatt----ggggggataggggaaattggtctatggtcaggtcatgcaggaggaaagcgacgcaaccagaggatagaggac 174  Q
    ||||||||||||||||||||||    |||||||||||||| |||||||| ||||  ||||  | | ||||||||||||| |||||||  |||||||||    
T  22262823 tccagctagggtggcagaaattagggggggggataggggagattggtctgtggtgcggtcgaggaagaggaaagcgacggaaccagatcatagaggac 22262726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0031 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0031
Description:

Target: scaffold0031; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 88 - 122
Target Start/End: Complemental strand, 101577 - 101543
Alignment:
Q  88 agggtggcagaaattggggggataggggaaattgg 122  Q
    ||||||||||||||||||||||||||||| |||||    
T  101577 agggtggcagaaattggggggataggggagattgg 101543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University