View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11809_high_38 (Length: 363)
Name: NF11809_high_38
Description: NF11809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11809_high_38 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 1 - 355
Target Start/End: Complemental strand, 40771332 - 40770975
Alignment:
| Q |
1 |
tgatttttgttattgttttgttaatagatgcaaagctacctttgtatgcttttaaaaagattgacaaagtaactgaaaaggatttggctatccatgagtg |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40771332 |
tgattttggttattgttttgttaatagatgcaaagctacctttgtatgcttttaaaaagattgacaaagtaaccgaaaaggatttggctatccatgagtg |
40771233 |
T |
|
| Q |
101 |
tcaagaggagcttcctatggcctttttggactcacttgttcttggagaggtgattattgaattttgattatgaagaatgattaaagattttaa---nnnn |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40771232 |
tcaagaggagcttcctatggcctttttggactcacttgttcttggagaggtgattattgaattttgattatgaagaatgattaaagattttaattttaat |
40771133 |
T |
|
| Q |
198 |
nnnnnnnatctttttgtttaaaaggtctattactcttttcatttcagtgggaagatcgcatgcaaagaggactttttcgttatgatgttaccgcctgtga |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40771132 |
tttttttatctttttgtttaaaaggtctattactcttttcatttcagtgggaagatcgcatgcaaagaggactttttcgttatgatgttaccgcctgtga |
40771033 |
T |
|
| Q |
298 |
aaccaaggtttgatactttgattctttgttcttttttgggggattttgtgtgtctgtg |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40771032 |
aaccaaggtttgatactttgattctttgttcttttttgggggattttgtgtgtttgtg |
40770975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 243 - 310
Target Start/End: Complemental strand, 21012859 - 21012792
Alignment:
| Q |
243 |
agtgggaagatcgcatgcaaagaggactttttcgttatgatgttaccgcctgtgaaaccaaggtttga |
310 |
Q |
| |
|
||||||| ||||||||||| ||||| | || ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
21012859 |
agtgggaggatcgcatgcagagagggttgttccgttacgatgttactgcctgtgaaaccaaggtttga |
21012792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University