View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11809_high_48 (Length: 304)
Name: NF11809_high_48
Description: NF11809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11809_high_48 |
 |  |
|
| [»] scaffold0650 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0650 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: scaffold0650
Description:
Target: scaffold0650; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 1 - 292
Target Start/End: Original strand, 2107 - 2397
Alignment:
| Q |
1 |
tgttctatttgtttgttgacaatagtgaaaatctttgttacttagttgaaaattgagagtatattgtgaggaattataagatgagcaacgtgacgccaat |
100 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2107 |
tgttctatttttttgttgacaatattgaaa-tctttgttacttagttgaaaattgagagtatattgtgaggaattataagatgagcaacgtggcgccaat |
2205 |
T |
 |
| Q |
101 |
cgttagtaaactctattgttcgtcgtcgcagacggtgttgggtgtgaggaaaaggccacatgtagtgaatggtggtggatttgtagtcacggattgtagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2206 |
cgttagtaaactctattgttcgtcgtcgcagacggtgttgggtgtgaggaaaaggccacatgtagtgaatggtggtggatttgtagtcacggattgtagg |
2305 |
T |
 |
| Q |
201 |
actcaaaaggttgttttcaaggttgatggttgtggaattcatgggaaaaaagaagagttgattctaagagatggagatagagaacctttgct |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2306 |
actcaaaaggttgttttcaaggttgatggttgtggaattcatgggaaaaaagaagagttgattctaagagatggagatggagaacctttgct |
2397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University