View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11809_high_57 (Length: 272)
Name: NF11809_high_57
Description: NF11809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11809_high_57 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 46264545 - 46264292
Alignment:
| Q |
1 |
gatacattgctcaaatagattctttaccgactactttcatcatatcggctttagttacacaatgtcagataaaagaaaccttagcaacacttgcacatac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46264545 |
gatacattgctcaaatagattctttaccgactactttcatcatatcggctttagttacacaatgtcagataaaagaaaccttagcaacacttgcacatac |
46264446 |
T |
 |
| Q |
101 |
acacagaaacacctgtgacgctaatgggtctacttgtttcatatactgtggatctacaaacttgttatcataaagtcttctattaccatttgatgctttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
46264445 |
acacagaaacacctgtgacgctaatgggtctacttgtttcatatactgtggatctacaaacttattatcataaagtcttctattaccatttgatgctttt |
46264346 |
T |
 |
| Q |
201 |
cagaatgccatctctccgaagggaaatgaagtgaatttgacccttggcggcatc |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46264345 |
cagaatgccatctctccgaagggaaatgaagtgaatttgacccttggcggcatc |
46264292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University