View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11809_high_60 (Length: 270)
Name: NF11809_high_60
Description: NF11809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11809_high_60 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 15 - 227
Target Start/End: Complemental strand, 457382 - 457170
Alignment:
| Q |
15 |
ggagcagagaggctctataaatttactattttccattggtcatcagataaatagcgagtccatgattcttccatttatcctcgtcctcgccttatttgac |
114 |
Q |
| |
|
|||| ||| ||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
457382 |
ggaggagaaaggctctgtaaatttactattttccattggtcatcagataaatagtgagtccatgattcttccatttatcctcgtcctcgccttatttgac |
457283 |
T |
 |
| Q |
115 |
tttgacaatgttttgctttggacatatgaaatttccttagtttcacacaaaatttggttttgtgacgccattgacattttctattatcttaacacaagac |
214 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
457282 |
tttgacaatgttttgctttggacacatgaaatttccttagtttcacacaaaatttggttttgtgacgccattgacattttctattatcttaacacaagac |
457183 |
T |
 |
| Q |
215 |
tttttctattatt |
227 |
Q |
| |
|
||||| ||||||| |
|
|
| T |
457182 |
tttttttattatt |
457170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University