View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11809_high_66 (Length: 259)
Name: NF11809_high_66
Description: NF11809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11809_high_66 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 2013893 - 2013643
Alignment:
| Q |
1 |
acacctctgatcatttatttttcttcaaattattatcagtgtataagtatcagtgtcgtgtcaggtgtctgtgtaggtttttcataggtgtatgtttgga |
100 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2013893 |
acacctctgatcattttttttt--tcaaattattatctgtgtataagtatcagtgtcgtgtctcgtgtctgtgtaggtttttcataggtgtatgtttgga |
2013796 |
T |
|
| Q |
101 |
ggaattagacatggaaatgaaaattagaagaacagagtaaaaaatgaatcatcagaaacaacaagaacaccaacttgcgttgcgttcaacagaaatgata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2013795 |
ggaattagacatggaaatgaaaattagaagaacaaagtaaaaaatgaatcatcagaaacaacaagaacaccaacctgcgttgcgttcaacagaaatgata |
2013696 |
T |
|
| Q |
201 |
atgggaagcgcgggaaggaaacgagatgcaaacaactctggatttcatctcac |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2013695 |
gtgggaagcgcgggaaggaaacgagatgcaaacaactctggatttcatctcac |
2013643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University