View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11809_high_85 (Length: 241)

Name: NF11809_high_85
Description: NF11809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11809_high_85
NF11809_high_85
[»] chr8 (1 HSPs)
chr8 (1-69)||(7509114-7509182)
[»] chr3 (2 HSPs)
chr3 (3-69)||(27241492-27241558)
chr3 (7-56)||(27249111-27249160)


Alignment Details
Target: chr8 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 7509114 - 7509182
Alignment:
1 ttggtaaatcaaatttcttcctctccccattttgaattgcattaaggagaatggtggcaccttgcttca 69  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7509114 ttggtaaatcaaatttcttcctctccccattttgaattgcattaaggagaatggtggcaccttgcttca 7509182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 3 - 69
Target Start/End: Complemental strand, 27241558 - 27241492
Alignment:
3 ggtaaatcaaatttcttcctctccccattttgaattgcattaaggagaatggtggcaccttgcttca 69  Q
    ||||||||||||||||||||||| |||||||||||||||||||| ||||||||| ||| ||| ||||    
27241558 ggtaaatcaaatttcttcctctcaccattttgaattgcattaagaagaatggtgacacattgattca 27241492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 56
Target Start/End: Complemental strand, 27249160 - 27249111
Alignment:
7 aatcaaatttcttcctctccccattttgaattgcattaaggagaatggtg 56  Q
    |||| |||||||||||||| |||||||||||||||||||| |||||||||    
27249160 aatcgaatttcttcctctcgccattttgaattgcattaagaagaatggtg 27249111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University