View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11809_high_91 (Length: 238)
Name: NF11809_high_91
Description: NF11809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11809_high_91 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 13 - 215
Target Start/End: Complemental strand, 44017417 - 44017215
Alignment:
| Q |
13 |
agcagagacaaagatagttaaggtacattctggtatatgtctaagataacaaatagaaagctttgtccattcctttttgaccattctctcatctctatta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44017417 |
agcagagacaaagatagttaaggtacattctggtatatgtctaagataacaaatagaaagctttgtccattcctttttgaccattctctcatctctatta |
44017318 |
T |
|
| Q |
113 |
tctcccttcttaaacatactacttgacactatctctttttgtttcacatgcttttgtttaaaacgtttgtgtgaaacttaagcatcatgcatgtgctctc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44017317 |
tctcccttcttaaacatactacttgacactatctctttttgtttcacatgcttgtgtttaaaacgtttgtgtgaaacttaagcatcatgcatgtgctctc |
44017218 |
T |
|
| Q |
213 |
cta |
215 |
Q |
| |
|
||| |
|
|
| T |
44017217 |
cta |
44017215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 81 - 201
Target Start/End: Original strand, 31037093 - 31037218
Alignment:
| Q |
81 |
attcctttttgaccattctctc--atctctattatctcccttcttaaacatac---tacttgacactatctctttttgtttcacatgcttttgtttaaaa |
175 |
Q |
| |
|
|||||||||||| ||||||||| | ||||||| ||| |||||||||| ||| ||||||||| |||||| ||| | |||||| || ||| |||| |
|
|
| T |
31037093 |
attcctttttgaacattctctctcagctctattttcttccttcttaaagataacaatacttgacaatatctcctttcatgtcacattctagtgtcgaaaa |
31037192 |
T |
|
| Q |
176 |
cgtttgtgtgaaacttaagcatcatg |
201 |
Q |
| |
|
| |||||||||||| ||||||||||| |
|
|
| T |
31037193 |
catttgtgtgaaacctaagcatcatg |
31037218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University