View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11809_high_96 (Length: 232)
Name: NF11809_high_96
Description: NF11809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11809_high_96 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 7 - 232
Target Start/End: Complemental strand, 35560083 - 35559858
Alignment:
| Q |
7 |
ctctgttgggacactgtttcatcaaacacaacgtttgaaacaagaaggctttacaacaacaacaatggcactgttctatacgagaatcttgctgttggtg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35560083 |
ctctgttgggacactgtttcatcaaacacaacgtttgaaacaagaaggctttacaacaacaacaatggaactgttctatacgagaatcttgctgttggtg |
35559984 |
T |
|
| Q |
107 |
attcacatgtttgtgctacaatggttaatgttggaaacgttgcttgttggagaatgaataaaggttttgttttgccatctgggtttgatcaattttcttc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35559983 |
attcacatgtttgtgctacaatggttaatgttggaaacgttgcttgttggagaatgaataaaggttttgttttgccatctgggtttgatcaattttcttc |
35559884 |
T |
|
| Q |
207 |
aataacttctgggtttggtttcactt |
232 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
35559883 |
aataacttctgggtttggtttcactt |
35559858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University