View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11809_high_98 (Length: 229)
Name: NF11809_high_98
Description: NF11809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11809_high_98 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 84 - 229
Target Start/End: Complemental strand, 8546576 - 8546431
Alignment:
| Q |
84 |
gtgtgttgttctttactttcattagtacaacatattatagatcaccattttagggcttgtttactttctaaaaac--atatttggtattcattttaaatt |
181 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8546576 |
gtgtgttgttctttactttaattagtacaacatattatagatcaccattttagggcttgtttactttctaaaaacatatatttggtattcattttaaatt |
8546477 |
T |
 |
| Q |
182 |
gctaacatgggtttgatatactcatatagttaataattgtgctagata |
229 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8546476 |
gctaacatgggtttgatatactc--atagttaataattgtgctagata |
8546431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 7 - 49
Target Start/End: Complemental strand, 8546653 - 8546611
Alignment:
| Q |
7 |
gtatttggtaatttacttattcttttgttgcagcactgtttaa |
49 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8546653 |
gtatttggtaatttacttattcttttgttccagcactgtttaa |
8546611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University