View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11809_high_99 (Length: 227)

Name: NF11809_high_99
Description: NF11809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11809_high_99
NF11809_high_99
[»] chr7 (1 HSPs)
chr7 (1-227)||(19907720-19907946)


Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 19907946 - 19907720
Alignment:
1 ggatatgaggaattgacctaccctggtggatataagggattggtggggttcttggggctaatattagcaaaaatttgtgcagaattatgggaaaattgcc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19907946 ggatatgaggaattgacctaccctggtggatataagggattggtggggttcttggggctaatattagcaaaaatttgtgcagaattatgggaaaattgcc 19907847  T
101 tggtctcttatacgaaaatttagaaggacaattttaaatgggaaagggaagctcaagatgcctttgtgcctcttaacacagaaatggtaagtggctactc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19907846 tggtctcttatacgaaaatttagaaggacaattttaaatgggaaagggaagctcaagatgcctttgtgcctcttaacacagaaatggtaagtggctactc 19907747  T
201 tttttatattgggagtttcaaatttca 227  Q
    |||||||||||||||||||||||||||    
19907746 tttttatattgggagtttcaaatttca 19907720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University