View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11809_low_101 (Length: 236)
Name: NF11809_low_101
Description: NF11809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11809_low_101 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 118 - 167
Target Start/End: Original strand, 21583979 - 21584028
Alignment:
| Q |
118 |
tttcattagctttttaaaataacttatgaaaatagattattcatatgttc |
167 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
21583979 |
tttcattggctctttaaaataacttatgaaaatagattatccatttgttc |
21584028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Original strand, 21584070 - 21584108
Alignment:
| Q |
183 |
acattgcagcagaagcttagttttgtagcttcaataaac |
221 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
21584070 |
acattgccgcagaagcttagttttgtagcttcagtaaac |
21584108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University