View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11809_low_103 (Length: 232)
Name: NF11809_low_103
Description: NF11809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11809_low_103 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 18 - 217
Target Start/End: Complemental strand, 2475342 - 2475142
Alignment:
| Q |
18 |
ggatcatctaacatatcattat-aggattctgcatagttatgatggagactaggttttttcctctctcttagctagcacacgtcttctctctttcttgaa |
116 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| ||| ||||||||| |
|
|
| T |
2475342 |
ggatcatctaacatatcattatcaggattctgcatagttatgatggagaataggttttttcctctctcttagctagcacatgtcttttctatttcttgaa |
2475243 |
T |
|
| Q |
117 |
tgaatgttttatgtatgcttctcaggaagccgattcatttcgatcatgcaaaactttcccaaacaatttctcttttagccattggtgcataccattgatg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2475242 |
tgaatgttttatgtatgcttctcaggaagccaattcatttcgatcatgcaaaactttcccaaacaatttctcttttagccattggtgcataccattgatg |
2475143 |
T |
|
| Q |
217 |
t |
217 |
Q |
| |
|
| |
|
|
| T |
2475142 |
t |
2475142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University