View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11809_low_108 (Length: 218)

Name: NF11809_low_108
Description: NF11809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11809_low_108
NF11809_low_108
[»] chr6 (1 HSPs)
chr6 (1-200)||(3855773-3855972)


Alignment Details
Target: chr6 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 3855773 - 3855972
Alignment:
1 cattattacatcctttaatttccgtcaaataacaaatagtgatactcttnnnnnnntctctagataaatagcgatactcttcaaaaaatgtcaggcgcca 100  Q
    ||||||||||||| ||||||||||||||||||||| ||| |||||||||       ||||||||||||||||||||||||||||||||||||||||||||    
3855773 cattattacatcccttaatttccgtcaaataacaagtagcgatactcttcaaaaaatctctagataaatagcgatactcttcaaaaaatgtcaggcgcca 3855872  T
101 agggacattggacaaaccacaatnnnnnnntttaggtgaaattggcgccaatcatgaatattgtgatgccaattatattaaggccaagcaatacacatat 200  Q
    |||||||||||||||||||||||       |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
3855873 agggacattggacaaaccacaataaaaaaatttaggtgaaattggcgcgaatcatgaatattgtgatgccaattatattaaggccaagcaatacacatat 3855972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University