View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11809_low_108 (Length: 218)
Name: NF11809_low_108
Description: NF11809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11809_low_108 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 3855773 - 3855972
Alignment:
| Q |
1 |
cattattacatcctttaatttccgtcaaataacaaatagtgatactcttnnnnnnntctctagataaatagcgatactcttcaaaaaatgtcaggcgcca |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| ||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3855773 |
cattattacatcccttaatttccgtcaaataacaagtagcgatactcttcaaaaaatctctagataaatagcgatactcttcaaaaaatgtcaggcgcca |
3855872 |
T |
 |
| Q |
101 |
agggacattggacaaaccacaatnnnnnnntttaggtgaaattggcgccaatcatgaatattgtgatgccaattatattaaggccaagcaatacacatat |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3855873 |
agggacattggacaaaccacaataaaaaaatttaggtgaaattggcgcgaatcatgaatattgtgatgccaattatattaaggccaagcaatacacatat |
3855972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University