View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11809_low_26 (Length: 424)
Name: NF11809_low_26
Description: NF11809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11809_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 220
Target Start/End: Complemental strand, 39499118 - 39498916
Alignment:
| Q |
18 |
ggattaggggtgatgatggttgtattgatgatgatgttaaacttgtctacttgttcagcttggtttggtaataaacgcaaaattggaagaaactcaattt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39499118 |
ggattaggggtgatgatggttgtattgatgatgatgttaaacttgtctacttgttcagcttggtttggtaataaacgcaaaagtggaagaaactcaattt |
39499019 |
T |
 |
| Q |
118 |
taccaggtgaagctatgtcttcaagaccaagtctcatgaaccatgctgctggttcctcaattgtgttccctatttatggcaatgtttatcctgttgggta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39499018 |
taccaggtgaagctatgtcttcaagaccaagtctcatgaaccatgctgctggttcctcaattgtgttccctatttatggcaatgtttatcctgttgggta |
39498919 |
T |
 |
| Q |
218 |
tga |
220 |
Q |
| |
|
||| |
|
|
| T |
39498918 |
tga |
39498916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 383 - 414
Target Start/End: Complemental strand, 39498762 - 39498731
Alignment:
| Q |
383 |
gaaagatgtgagtatccaaattcatacctttg |
414 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
39498762 |
gaaagatgtgagtatccaaattcatacctttg |
39498731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University