View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11809_low_31 (Length: 398)
Name: NF11809_low_31
Description: NF11809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11809_low_31 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 357; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 357; E-Value: 0
Query Start/End: Original strand, 18 - 386
Target Start/End: Complemental strand, 55382942 - 55382574
Alignment:
| Q |
18 |
cttggaacccctcatcatccacctccaaaaggcgtccctggtgttatcgatcaaaccaggggtctccttgattatgttcaacaatattgctccaaacctg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55382942 |
cttggaacccctcatcatccacctccaaaaggcgtccctggtgttatcgatcaaaccaggggtctccttgattatgttcaacaatattgctccaaacctg |
55382843 |
T |
|
| Q |
118 |
tttacacccctcacctcaagtatgtatgcatagcaggaaggtaacacctacactctttcaaggaaacatacatccctcaaaagtagtcttttttgatact |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
55382842 |
tttacacccctcacctcaagtatgtatgcatagcaggaaggtaacacccacactctttcaaggaaacttacatccctcaaaagtagtcttttttgatact |
55382743 |
T |
|
| Q |
218 |
caacttctacaatttataaaatgcagaccatgccaacacaaacataacttactatacaatcaattattcatttcatttcttactacaaaatgaaggtata |
317 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55382742 |
caatttctacaatttataaaatgcagaccatgccaacacaaacataacttactatacaatcaattattcatttcatttcttactacaaaatgaaggtata |
55382643 |
T |
|
| Q |
318 |
ttcaaggggctcccctttttggaaactcaaatccaaatgctgagcctgcacttcctacagatacttctc |
386 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55382642 |
ttcaaggggctcccctttttggaaactcaaatccaaatgctgagcctgcacttcctacagatacttctc |
55382574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University