View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11809_low_46 (Length: 330)
Name: NF11809_low_46
Description: NF11809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11809_low_46 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 15 - 227
Target Start/End: Complemental strand, 25727742 - 25727531
Alignment:
| Q |
15 |
aattgccgctcaatttgtagagcaaacaaattcaaatcatttttaaaatacatggacactattttaaaattacgttaattattatacacccataatgtaa |
114 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25727742 |
aattgccgctcaatttgtagagcaaacaacttcaaataatttttaaaatacatcgacactattttaaaattacgttaattattatacacccataatgtaa |
25727643 |
T |
 |
| Q |
115 |
aatgtatttcatgtcaattatgtttatgataacttattatttgaagcaacgacacatcattgaatatacannnnnnnnaggaaatcattgaatatacatg |
214 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25727642 |
aatgtatttcatgtcaattatatttatgataacttattaattgaagcaacgacacatcattgaatataca-tttttttaggaaatcattgaatatacatg |
25727544 |
T |
 |
| Q |
215 |
taaaccaagtaag |
227 |
Q |
| |
|
||||||||||||| |
|
|
| T |
25727543 |
taaaccaagtaag |
25727531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University