View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11809_low_48 (Length: 314)
Name: NF11809_low_48
Description: NF11809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11809_low_48 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 22 - 272
Target Start/End: Original strand, 5891478 - 5891729
Alignment:
| Q |
22 |
tttgcaagtggttgaacttttgtattatctacactcttttttacttcaacaaagttttatatcttattggatttttctagtcagatttttaacgagacag |
121 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5891478 |
tttgcaagtggttgaacttttgtatgatctacactcttttttacttcaacaaagttttatatcttattggatttttctagtcagatttttaacgagacag |
5891577 |
T |
 |
| Q |
122 |
tttatgttcttgagtatttgtgttggatttttgtctaatgtccaatatttatattttcactttactaaattggatcg-caagaaaattatcggatcaaat |
220 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5891578 |
tttatgttcttgagtatttgttttggatttttgtctaatgtccaatatttatattttcactttactaaattggatcgccaagaaaattatcggatcaaat |
5891677 |
T |
 |
| Q |
221 |
tgaatctttgctttcataataaacaagaattaggagttatgaaatacgaaca |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5891678 |
tgaatctttgctttcataataaacaagaattaggagttatgaaacacgaaca |
5891729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University