View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11809_low_52 (Length: 300)
Name: NF11809_low_52
Description: NF11809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11809_low_52 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 69 - 223
Target Start/End: Original strand, 40771431 - 40771585
Alignment:
| Q |
69 |
tagtaccttgaatacaacaagatttgagacaattccgaccacaacctccgacagtacgaggagcagcctctccaacctcctctttttgataattggaaac |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40771431 |
tagtaccttgaatacaacaagatttgagacaattccgaccacaacctccgacagtacgaggagcagcctctccaacctcctctttttgataattggaaac |
40771530 |
T |
 |
| Q |
169 |
aacggtgggaacccttttgatttttagcatcattttcaccaaaccaaacacaaaa |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40771531 |
aacggtgggaacccttttgatttttagcatcattttcaccaaaccaaacacaaaa |
40771585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 252 - 284
Target Start/End: Original strand, 40771625 - 40771657
Alignment:
| Q |
252 |
aagaagaagcaccttcaaataaatcttacttac |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
40771625 |
aagaagaagcaccttcaaataaatcttacttac |
40771657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University