View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11809_low_53 (Length: 291)
Name: NF11809_low_53
Description: NF11809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11809_low_53 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 66 - 281
Target Start/End: Original strand, 33495348 - 33495563
Alignment:
| Q |
66 |
accatctgcaccttcaccatgaatcttgtccttgatcttgtcaacaaatccctccttgtgctcttctccatggtgtccttccttgtggtctccatgacca |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33495348 |
accatctgcaccttcaccatgaatcttgtccttgatcttgtcaacaaatccctccttgtgctcttccccatggtgtccttccttgtggtctccatgacca |
33495447 |
T |
 |
| Q |
166 |
aatccatgttgctctcctttgtgctcaccaccatgtcctcctacaaatccatgttgttctcctttgtactcaccatggtgttctcctcctacatgtccat |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33495448 |
aatccatgttgctctcctttgtgctcaccaccatgtcctcctacaaatccatgttgttctcctttgtactcaccgtggtgttctcctcctacatgtccat |
33495547 |
T |
 |
| Q |
266 |
gttgttctcctctgtg |
281 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
33495548 |
gttgttctcctttgtg |
33495563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University