View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11809_low_54 (Length: 290)
Name: NF11809_low_54
Description: NF11809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11809_low_54 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 98 - 244
Target Start/End: Original strand, 303968 - 304126
Alignment:
| Q |
98 |
tggtgtattgcttcctagcttgatttccaattaaaattgtcatatgatcgatgatatggatttagtagtgttattttctttgatataattgaatg----- |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
303968 |
tggtgtattgcttcctagcttgatttccaattaaaattgtcatataatcgatgatatggatttagtagtgttattttcttttatataattgaatgaaaca |
304067 |
T |
|
| Q |
193 |
-------gcattacatgttgaattataatcttaattttgtccattggagactattccat |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
304068 |
acactatgcattacatgttgaattataatcttaatttggtccattggagactattccat |
304126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 1 - 99
Target Start/End: Original strand, 303829 - 303927
Alignment:
| Q |
1 |
cttatgggaaggatggcttttaatggcaatactaattttgtttatcctatcaacattcaccatcttgctcaactataataatatttcaactcttttatg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
303829 |
cttatgggaaggatggcttttaatggcaataccaattttgtttatcctatcaacattcaccaacttgctcaactataataatatttcaactcttctatg |
303927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University