View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11809_low_57 (Length: 287)
Name: NF11809_low_57
Description: NF11809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11809_low_57 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 1e-78; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 32822865 - 32823080
Alignment:
| Q |
1 |
tctcagtgtcttgagaaattagttcaactcttacatatatgtattgaagacaccaagtttcattatctccccaactgagagttaggacgtaactaatttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||||||||||||||| ||| ||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
32822865 |
tctcagtgtcttgagaaattagttcaattcttacatgtatgtattgaagacactaaggttcattatctcaccaactgaaagttaggacgtaactaatttc |
32822964 |
T |
|
| Q |
101 |
ttaaaataccgatagtcttaagattatcggtatccattaa------aatggatactgatatcttaagaaattagttacctttggtgagataatgaatgtc |
194 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||| |||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32822965 |
ttaaaataccgatattcttaagattatcagtatccgttaaaatgataatggatactggtatcttaagaaattagttacctttggtgagataatgaatgtc |
32823064 |
T |
|
| Q |
195 |
attatctcgaggaatt |
210 |
Q |
| |
|
|||||||||| ||||| |
|
|
| T |
32823065 |
attatctcgaagaatt |
32823080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 239 - 271
Target Start/End: Original strand, 32823079 - 32823111
Alignment:
| Q |
239 |
ttggctatgtcaaattaaaattattgaaatttg |
271 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
32823079 |
ttggctatgtcgaattaaaattattgaaatttg |
32823111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University