View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11809_low_73 (Length: 259)

Name: NF11809_low_73
Description: NF11809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11809_low_73
NF11809_low_73
[»] chr4 (1 HSPs)
chr4 (179-247)||(28075376-28075444)


Alignment Details
Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 179 - 247
Target Start/End: Complemental strand, 28075444 - 28075376
Alignment:
179 caacagctacccaaacacattcttatgttattagcttcagcacctagaatgagtaaaatcatctgtgct 247  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| | |||| |||||||||    
28075444 caacagctacccaaacacactcttatgttattagcttcagcacctagaatgattgaaattatctgtgct 28075376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University