View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11809_low_76 (Length: 257)
Name: NF11809_low_76
Description: NF11809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11809_low_76 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 146
Target Start/End: Original strand, 18612722 - 18612867
Alignment:
| Q |
1 |
atgaagatgaagatgaagatgagtatgaagaggagcttaaaaatagtgttgtggagaaaggatgcaaatgggtcaagacaaattccgaatgtaagttcta |
100 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18612722 |
atgaagatgaatatgaatatgagtatgaagaggagcttaaaaatagtgttgtggagaaaggatgcaaatgggtcaagacaaattccgaatgtaagttcta |
18612821 |
T |
|
| Q |
101 |
tcattgatttgtttatttataatatagtatgacattcgtaatttgt |
146 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
18612822 |
tcattgatttgtttatttatagtatagtatggcattcgtaatttgt |
18612867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University