View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11809_low_82 (Length: 250)
Name: NF11809_low_82
Description: NF11809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11809_low_82 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 19 - 240
Target Start/End: Original strand, 12692291 - 12692512
Alignment:
| Q |
19 |
acaactgacaaagaaaccaatgtaaagaacaccgacgagatcgacaaacacttgttaactcagtcactatatcaacgtccatgtgatgtgtccatgagac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12692291 |
acaactgacaaagaaaccaatgtaaagaacaccgacgagatcgacaaacacttgttaactcagtcactatatcaacgtccatgtgatgcgtccatgagac |
12692390 |
T |
 |
| Q |
119 |
actgaacgtcttcgacattgttgattctagatatgactaagatgggttgcctcgagcaaaaaattcttgtatagtactcttctgcaatgaaggaaaccaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12692391 |
actgaacgtcttcgacattgttgattctggatatgactaagatgggttgcctcgagcaaaaaattcttgtatagtactcttctgcaatgaaggaaaccaa |
12692490 |
T |
 |
| Q |
219 |
cggttatgacctccccttcatc |
240 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
12692491 |
cggttatgacctccccttcatc |
12692512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University