View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11809_low_83 (Length: 250)
Name: NF11809_low_83
Description: NF11809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11809_low_83 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 11 - 234
Target Start/End: Complemental strand, 8293717 - 8293493
Alignment:
| Q |
11 |
cagagatgcaattaattatatggagatcaaatgcacatgacacggacgctatacaaaacgcagcaacaaaatatctggaatcagagaaattaacacggaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8293717 |
cagagatgcaattaattatatggagatcaaatgcacatgacacggacgctatacaaaacgcagcaacaaaatatctggaatcagagaaattaacacggaa |
8293618 |
T |
 |
| Q |
111 |
gagaagaga-aaaataaatggacacataagatttaccagtttcaatcaattgtaagcagctccacaggttcaaactttcatgatgtattttctctttgat |
209 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8293617 |
gagaagagaaaaaataaatggacacataagatttaccagtttcagtcaattgtaagcagctccacaggttcaaactttcatgatgtattttctctttgat |
8293518 |
T |
 |
| Q |
210 |
tttctcaattttcctctcaaagatg |
234 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
8293517 |
tttctcaattttcctctcaaagatg |
8293493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University