View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11809_low_87 (Length: 247)
Name: NF11809_low_87
Description: NF11809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11809_low_87 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 231; Significance: 1e-128; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 44378042 - 44378284
Alignment:
| Q |
1 |
ttgttctgatgtttgttgacctaagcttcccataatggaaccgagttctgatgcagagatcttgccatcgccgttgacgtcgaattttttgaagacttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44378042 |
ttgttctgatgtttgttgacctaagcttcccataatggaaccgagttctgatgcagagatcttgccatcgccgttgacgtcgaattttttgaagacttct |
44378141 |
T |
 |
| Q |
101 |
tcgagttcgccggcgagacgggtgcgtgaacgtacggagagggaggtggatcgggaaggagggtctgaggatgaagatggcttgttgaacattgatttca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
44378142 |
tcgagttcgccggcgagacgggtgcgtgaacgtacggagagggaggtagatcgggaaggagggtctgaagatgaagatggcttgttgaacattgatttca |
44378241 |
T |
 |
| Q |
201 |
aacccatgggcatgacttgttttttcttctccttcttcttctt |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44378242 |
aacccatgggcatgacttgttttttcttcttcttcttcttctt |
44378284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University