View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11809_low_91 (Length: 242)
Name: NF11809_low_91
Description: NF11809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11809_low_91 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 14 - 214
Target Start/End: Original strand, 40466806 - 40467006
Alignment:
| Q |
14 |
atgaatgtcgtgagcgtttattaaaagatatacaagaaaagtgatctatatgctcaatatttttaggttttaatgaagatgtaattgtttgctctttaga |
113 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| | |||||||||||||| || |
|
|
| T |
40466806 |
atgaatgtcgtgagtatttattaaaagatatacaagaaaagtgatttatatgctcaatatttttaggttttaatgaagatatgattgtttgctctttcga |
40466905 |
T |
 |
| Q |
114 |
tagttaatcttcaacatgtgtaagttaaacacaagaaatcaaccgtgttgaagttcaagtgtgagttgctagtgagatatcaactagatgaaagatatat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40466906 |
tagttaatcttcaacatgtgtaagttaaacacaagaaatcaaccgtgttgaagttcaagtgtgagttgctagtgagatatcaactagatgaaagatatat |
40467005 |
T |
 |
| Q |
214 |
a |
214 |
Q |
| |
|
| |
|
|
| T |
40467006 |
a |
40467006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University