View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11809_low_93 (Length: 241)
Name: NF11809_low_93
Description: NF11809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11809_low_93 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 7509114 - 7509182
Alignment:
| Q |
1 |
ttggtaaatcaaatttcttcctctccccattttgaattgcattaaggagaatggtggcaccttgcttca |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7509114 |
ttggtaaatcaaatttcttcctctccccattttgaattgcattaaggagaatggtggcaccttgcttca |
7509182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 3 - 69
Target Start/End: Complemental strand, 27241558 - 27241492
Alignment:
| Q |
3 |
ggtaaatcaaatttcttcctctccccattttgaattgcattaaggagaatggtggcaccttgcttca |
69 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| ||||||||| ||| ||| |||| |
|
|
| T |
27241558 |
ggtaaatcaaatttcttcctctcaccattttgaattgcattaagaagaatggtgacacattgattca |
27241492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 56
Target Start/End: Complemental strand, 27249160 - 27249111
Alignment:
| Q |
7 |
aatcaaatttcttcctctccccattttgaattgcattaaggagaatggtg |
56 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
27249160 |
aatcgaatttcttcctctcgccattttgaattgcattaagaagaatggtg |
27249111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University