View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11809_low_97 (Length: 240)
Name: NF11809_low_97
Description: NF11809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11809_low_97 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 8e-82; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 18 - 179
Target Start/End: Original strand, 49820007 - 49820168
Alignment:
| Q |
18 |
cacaagatgctatatgcctgattgttgcaccaaaacaccatcatagtttagttaacttgtagtggtccagggggtggtggactcctagatgacatgacta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49820007 |
cacaagatgctatatgcctgattgttgcaccacaacaccatcatagtttagttaacttgtagtggtccagggggtggtggactcctagatgacatgacta |
49820106 |
T |
 |
| Q |
118 |
gtatgcatatgaagttgaaaaataatcttcaccttcaaataagttctcttgatgttagcaca |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
49820107 |
gtatgcatatgaagttgaaaaataatcttcacctgcaaataagttctcttgatgttagcaca |
49820168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 180 - 240
Target Start/End: Original strand, 49820197 - 49820257
Alignment:
| Q |
180 |
tatctagtccagtccatccatctattattatcaaaatccatccaattcattcattcatttt |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49820197 |
tatctagtccagtccatccatctattattatcaaaatccatccaattcattcattcatttt |
49820257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University