View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1180_high_9 (Length: 227)
Name: NF1180_high_9
Description: NF1180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1180_high_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 21549010 - 21548792
Alignment:
| Q |
1 |
cagattatagatctttgaatttagttattattcgctcctgcatgttaaaat-gttgcttacaatggtgacattttatgttctattttgtgatgtttcact |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21549010 |
cagattatagatctttgaatttagttattattcgctcctgcatgttaaaattgttgcttacaatggtgacattttatgttctattttgtgatgcttcact |
21548911 |
T |
|
| Q |
100 |
tttgttctttgccataagtgtgagattttctacaattattggtttcaatatttaatggaaaaaataaaggtttcaagtttcaatttaatcaggtagttta |
199 |
Q |
| |
|
||| ||||||| ||||||||||||||||||||||||| |||||||||||| |||||| ||||||||||| || |||||||| |||||||||||| |||| |
|
|
| T |
21548910 |
tttattctttgtcataagtgtgagattttctacaatttttggtttcaata--taatgg-aaaaataaaggctttaagtttcagtttaatcaggtaattta |
21548814 |
T |
|
| Q |
200 |
ttttcttgatcatgcctctata |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
21548813 |
ttttcttgatcatgcctctata |
21548792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University