View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11810_high_8 (Length: 479)
Name: NF11810_high_8
Description: NF11810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11810_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 404; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 404; E-Value: 0
Query Start/End: Original strand, 18 - 468
Target Start/End: Complemental strand, 54350887 - 54350440
Alignment:
| Q |
18 |
agttccaccgggatcaaaattatgtcgatgatgactcataatgaagctccaccatgctagtgttgatgcaaattagtgtgtgtttaaaacacttattaac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
54350887 |
agttccaccgggatcaaaattatgtcgatga---ctcataatgaagctccaccatgctagtgttgatgcaaattagtgtgtctttaaaacacttattaac |
54350791 |
T |
 |
| Q |
118 |
annnnnnngggtacaaattagtgtcaacatctttatactattttctttatttttccttcccaaaaacaaagtgtttttcgaaaacgacggtttgtcttac |
217 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
54350790 |
atttttttgggtacaaattagtgtcaacatctttatactattttctttatttttccttcccaaaaacaaagtgtttttcgaaaacgacagtttgtcttac |
54350691 |
T |
 |
| Q |
218 |
acctaaagatcacaacatataacatcctaattattttattgaatgggtgaaggccgtaaaggggacactcgttgctcagatacaatgtttagcataagtt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
54350690 |
acctaaagatcacaacatataacatcctaattattttattgaatgggtgaaggccgtaaaggggacactcgttgctcagatacaatgtttaacataagtt |
54350591 |
T |
 |
| Q |
318 |
gtattcgacaaaaacagtattgtattactagaacgttggcacatgcgaccttgtgttgtggtttttctgtgagatggtcaccaccaccacatgcactaac |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54350590 |
gtattcgacaaaaacagtattgtattactagaacgttggcacatgcgaccttgtgttgtggtttttctgtgagatggtcaccaccaccacatgcactaac |
54350491 |
T |
 |
| Q |
418 |
gccgacaagtcatgtcacgtatctctcgtttcagctcatatttttgttctt |
468 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54350490 |
gccgacaagtcatgtcacgtatctctcgtttcagctcatatttttgttctt |
54350440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University