View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11810_low_15 (Length: 296)
Name: NF11810_low_15
Description: NF11810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11810_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 20 - 287
Target Start/End: Complemental strand, 3004069 - 3003799
Alignment:
| Q |
20 |
gtgtaaaaccccccaactctctggaacaataattgtgggatgcattatagcttctatgctccgtgtcttaggcagtagtagtgcacctcacaatccatcg |
119 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3004069 |
gtgtaaaaccccctaactctctggaacaataattgtgggatgcattatagcttctatgctccgcgtcttaggcagtagtagtgcacctcacaattcatcg |
3003970 |
T |
|
| Q |
120 |
tcatggatggcactatgtgtggatcaatacacgcatcgtgtcatggacaatagatatatccggtttttccttctttctgggtgacccaatgctcatagca |
219 |
Q |
| |
|
| |||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
3003969 |
ttatggatggcactatgtgtagatcaatacacgcatcgggtcatggacaatagatatatccggtttttccttctttctgggcgacccaatgcttatagca |
3003870 |
T |
|
| Q |
220 |
tgcatcgcgtcatggacaatagatggctcgtctgcaattcttcatcccttgtc---ccatttcatctcact |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3003869 |
tgcatcgcgtcatggacaatagatggctcgtctgcaattcttcatcccttgtcccaccatttcatctcact |
3003799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University