View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11810_low_20 (Length: 240)
Name: NF11810_low_20
Description: NF11810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11810_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 143
Target Start/End: Original strand, 25784952 - 25785093
Alignment:
| Q |
1 |
tagaatgctacaaagactcgagtagggagatgctgcaaaataatttgtcattatt--agactatattaaacattggcaactcttttattttttgttaaag |
98 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||| |||||||||||||| ||| |||||||||| ||||||||||||| |||| ||| ||||||||| |
|
|
| T |
25784952 |
tagaatgctacaaagacttgtgtagggagatgctgcgaaataatttgtcatcattggagactatatt-aacattggcaact-ttttttttgttgttaaag |
25785049 |
T |
 |
| Q |
99 |
cttgtaaaaatataaagaatatcatcgaaaataatccaaattgaa |
143 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
25785050 |
cttgtaaaaa-ataaaaaatatcatcgaaaataatccaaattgaa |
25785093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University